Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: hub_32_GCA_029207785.1 Primary Table: hub_32_simpleRepeat Data last updated: 2023-04-10
Big Bed File: https://hgdownload.soe.ucsc.edu/hubs/GCA/029/207/785/GCA_029207785.1/bbi/GCA_029207785.1_bChaFas1.0.hap2.simpleRepeat.bb
Item Count: 473,154
Format description: Describes the Simple Tandem Repeats

field	example	description
`chrom`	JARCOR010000001.1	Reference sequence chromosome or scaffold
`chromStart`	102212437	Start position in chromosome
`chromEnd`	102212497	End position in chromosome
`name`	CAAAAAAACCCCCACA	Simple Repeats tag name
`period`	27	Length of repeat unit
`copyNum`	2.3	Mean number of copies of repeat
`consensusSize`	25	Length of consensus sequence
`perMatch`	91	Percentage Match
`perIndel`	5	Percentage Indel
`score`	93	Alignment Score = 2match-7mismatch-7*indel; minscore=50
`A`	68	Percent of A's in repeat unit
`C`	31	Percent of C's in repeat unit
`G`	0	Percent of G's in repeat unit
`T`	0	Percent of T's in repeat unit
`entropy`	0.90	Entropy
`sequence`	CAAAAAAACCCCCACAAAAACAAAA	Sequence of repeat unit element

Sample Rows

chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
JARCOR010000001.1	102212437	102212497	CAAAAAAACCCCCACA	27	2.3	25	91	5	93	68	31	0	0	0.90	CAAAAAAACCCCCACAAAAACAAAA
JARCOR010000001.1	102212452	102212547	AAAAAACAAAACA	14	7.1	13	73	14	68	74	25	0	0	0.82	AAAAAACAAAACA
JARCOR010000001.1	102212452	102212547	AAAAAACAAAACAAAA	26	3.5	27	82	12	106	74	25	0	0	0.82	AAAAAACAAAACAAAAAAAACCAAACA
JARCOR010000001.1	102212480	102212536	AAAAC	5	11.8	5	78	14	57	78	21	0	0	0.75	AAAAC
JARCOR010000001.1	102212480	102212545	AAAACCAAACCAAACA	19	3.5	19	75	6	62	76	23	0	0	0.78	AAAACCAAACCAAACAAAC
JARCOR010000001.1	102212505	102212539	AAAACAAACAAAAAAA	17	2.0	16	88	11	50	82	17	0	0	0.67	AAAACAAACAAAAAAA
JARCOR010000001.1	102213955	102214344	TCCTC	5	77.8	5	100	0	778	0	59	0	40	0.97	TCCTC
JARCOR010000001.1	102223162	102223206	TATATATAATACATAA	21	2.2	20	95	4	79	52	4	0	43	1.22	TATATATAATACATAATATA
JARCOR010000001.1	102225023	102225051	T	1	28.0	1	100	0	56	0	0	0	100	0.00	T
JARCOR010000001.1	102232150	102232202	AAAACAACAACAACA	15	3.3	15	81	5	50	65	30	3	0	1.10	AAAACAACAACAACA

Simple Repeats (hub_32_simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) on the 14 Mar 2023 Chamaea fasciata/GCA_029207785.1_bChaFas1.0.hap2/GCA_029207785.1 genome assembly, located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. There are 473,154 items in the track covering 95,113,928 bases, assembly size 1,194,527,585 bases, percent coverage % 7.96. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217 Credits This track was generated using a modification of a program developed by G. Miklem and L. Hillier (unpublished). References Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol. 1987 Jul 20;196(2):261-82. PMID: 3656447

Description

Methods

Credits

References

Credits

References